bacA [2019-07-15 09:35:39]

bacilysin biosynthesis protein, prephenate decarboxylase

Locus: BSU_37740

Isoelectric point: 7.90

Molecular weight: 23.18 kDa

Protein length: 204 aa

Gene length: 615 bp

Function: biosynthesis of the antibiotic bacilysin

Product: anticapsin biosynthesis protein, prephenate decarboxylase

Essential: no

Synonyms: ywfB,ipa-80d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Biosynthesis of antibacterial compounds
• Lifestyles → Coping with stress → Biosynthesis of antibacterial compounds

Gene

Coordinates: 3,873,566 3,874,180

The protein

Catalyzed reaction/ biological activity

• decarboxylation of prephenate PubMed

Expression and Regulation

Operons

• Genes: bacA-bacB-bacC-bacD-bacE-bacF
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • ScoC: repression, PubMed, in ScoC regulon

  Regulation

  • expression of the operon is strongly induced at the beginning of biofilm formation PubMed

Biological materials

Mutant

• MGNA-B239 (ywfB::erm), available at the NBRP B. subtilis, Japan
• BKE37740 (bacA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAGCACCAACCAATCTT, downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
• BKK37740 (bacA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAGCACCAACCAATCTT, downstream forward: _UP4_TTATTTGGAAAAGGAGACGT

References

Loading